12 applying a function to every element in an array and returning a new array
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... (54%) sequence and was flanked at the 5¢ and 3¢ ends by two classical pentameric ARE (AUUUA) motifs and an atypical AU-rich region (AUUUUAUAUAAU) immediately abutting 3¢ to the nonamer This 108...
- 14
- 635
- 0
PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc
Ngày tải lên :
06/03/2014, 13:20
... dreamed of fifty years ago — and also correctly model the heads and limbs of animals, we still hold our own, and are as far advanced in taxidermy as any other nation CHAPTER II DECOYING AND TRAPPING ... certain modern improvements in modelling and mounting, contains a mass of — for that day — valuable elementary information In fact, the French and German taxidermists were then far in advance ... through the aperture into the abdomen, and takes everything out except the kidneys and heart, another cleanses each of the viscera with palm wine and aromatic substances; lastly, having applied oil...
- 363
- 612
- 0
Báo cáo y học: "Fatal fulminant herpes simplex hepatitis secondary to tongue piercing in an immunocompetent adult: a case report" pptx
Ngày tải lên :
11/08/2014, 19:21
... etiology, as early initiation of therapy is imperative to prevent severe disease resulting in liver transplantation or death Abbreviations ALT: alanine transaminase; AST: aspartate aminotransferase; ... and ALT of 4000 U/liter The following day, her lab values increased to an AST of 9200 U/liter and an ALT of 4400 U/ liter Bilirubin and alkaline phosphatase were within normal limits Other laboratory ... necessary when a patient presents with constitutional symptoms and elevating AST and ALT, and these findings should prompt immediate antiviral therapy with acyclovir Risk factors for HSV hepatitis...
- 5
- 340
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
Ngày tải lên :
12/08/2014, 18:22
... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases ... of Bcl2, p53 and cytokeratins, in human and canine tumors and corresponding adjacent tissues, have been similar [8] In dogs, standard treatment for mammary gland cancer is surgical excision however, ... http://www.actavetscand.com/content/50/1/27 Patients were evaluated by clinical history and physical examination including mammary tumor measurement and inguinal and axillary nodes palpation, performed...
- 9
- 337
- 0
Unit 12- Reading - a new way to teach
Ngày tải lên :
23/04/2015, 14:00
... from other animals? Language and music Why is music a powerful mean of communication? Because it can express ideas, thoughts and feeling How can music entertain? It makes people happy and excited ... important events and on special occasions and sets the tone for them It adds joyfulness to the atmosphere of a festival and makes a funeral more solemn and mournful Music lulls babies to sleep at ... important events and on special occasions II - WHILE- READING While you read the text , the following tasks There are two things that make humans different from all other animals They are language...
- 8
- 224
- 0
Applying combinatorial techniques to two problems in computational biology
Ngày tải lên :
30/09/2015, 13:49
... important problems in this area since they are related to many critical applications, such as Human Genome Project and Genome to Life Project For the homology searching problem, the most popular tools ... research areas Although quite a lot of problems have been solved in the latest two decades, there are more and more new problems being discovered and waited to be solved Homology searching and ... they are changed separately But in real situations, different “half gapped seeds” are usually different in more than one parameters What will happen when more than one of them change simultaneously?...
- 94
- 204
- 0
12 principles for responding to negative comments in social media
Ngày tải lên :
30/11/2015, 10:38
... Online issues management principles • Actively listen for turbulence • Think laterally and connect the dots • Assume guilty until proved innocent • Everyone is a gatekeeper • Language is no barrier ... online conversations • Develop Online Response Manual • Identify & train teams • Initially… • Respond to misleading statements • Focus on your own channels QUESTIONS? CONNECT WITH ME: @cpownall ... on your own channels 12 online response principles • Move fast • Be accurate • Be flexible • Be open • Be sincere • Be human • • • • • • Be focused Follow-up Add value Take control Avoid fights...
- 18
- 280
- 0
Introduction to finite element analysis using MATLAB and abaqus
Ngày tải lên :
08/01/2014, 12:58
... MATLAB and Abaqus ® Amar Khennane Boca Raton London New York CRC Press is an imprint of the Taylor & Francis Group, an informa business © 2013 by Taylor & Francis Group, LLC MATLAB® is a trademark ... as they are very easily translated into matrices Although there are many ways of reading data in MATLAB, in what follows we will use an M-file, truss_1_data.m, to read the data relevant to the ... http://www.simulia.com/products/unified_fea.html Data input for a finite element analysis with Abaqus can be done either through Abaqus/CAE or CATIA, which are intuitive graphic user interfaces They also allow monitoring and viewing of...
- 486
- 1.7K
- 3
Guide to International Trade in Organics: Laws and Regulations pptx
Ngày tải lên :
07/03/2014, 08:20
... also links to sanitary/phytosanitary learning modules and training, and APHIS Services Global Directory (staff) 64 Fresh Fruits and Vegetables Import Manual USDA, Animal and Plant Health Inspection ... Compilation of standards texts and materials lists from Japan Agricultural Standards, European Regulation 2092/91, Quebec Organic Reference Standards, Bio Suisse Standards, IFOAM Basic Standards and ... Food Ingredients and Packaging; Food Labeling and Nutrition; Pesticides, Metals, Chemical Contaminants and Natural Toxins; and Seafood Imports and Exports See also: Questions and Answers about...
- 28
- 461
- 0
Starting and Running a Greeting Cards Business: Lots of Practical Advice to Help You Build an Exciting and Profitable Business
Ngày tải lên :
10/03/2014, 20:37
... such as drawing can produce interesting and quality cards Hand-finished cards This term applies to cards which are printed, and then have something extra added to make them into a semi-handmade card ... There are some amazing handmade cards on the market featuring a wide variety of materials and skills From embroidery to enamelling, today’s handmade cards break all the boundaries Small makers can ... great fun running a greeting cards business! Handmade cards Buying something that has been made by hand has always been a special experience Handmade chocolates, shoes and furniture have always...
- 240
- 714
- 0
how to use excel in analytical chemistry and in general scientific data analysis pptx
Ngày tải lên :
17/03/2014, 02:20
... inverse hyperbolic sine, arsinh, in radians: ASINH(0.5) ϭ0.481212 The inverse tangent, arctan, in radians: ATAN(0.5) ϭ0.463648 ϭATAN(y/x) The inverse hyperbolic tangent, artanh, in radians: ATANH(0.5) ... options: Install and use Analysis ToolPak, Supplemental information about statistical methods and algorithms, and Ways to analyze statistics Click on the first choice, and find out how to install the Analysis ... 98 are used Many exercises use the Solver and the Analysis ToolPak, both of which are available in the standard Excel packages but may have to be loaded separately, as add-ins, in case this was...
- 501
- 523
- 1
FAITHFUL TO FENWAY Believing in Boston, Baseball, and America’s Most Beloved Ballpark pdf
Ngày tải lên :
17/03/2014, 13:20
... shape my analysis As a child and as a teenager, I went to baseball games with my grandfather, father, and friends So, I get what baseball means as a familial and communal activity, exemplifying ... So as they say at the beginning of each baseball game at Fenway Park and in every other ballpark, stadium, sandlot, and backyard: “Play ball!” BOSTON BELIEVES Fenway Park, a “Lyrical Little Bandbox” ... “strange,” less anonymous, and less chaotic How these attachments are fostered and what places are deemed as irreplaceable and immutable, and for what reasons and purposes, are crucial for maintaining...
- 276
- 157
- 0
Báo cáo khoa học: "THE CONTRIBUTION OF PARSING TO PROSODIC PHRASING IN AN EXPERIMENTAL TEXT-TO-SPEECH SYSTEM" doc
Ngày tải lên :
24/03/2014, 02:20
... Boundary: perceptual and acoustic properties and syntactic and statistical determinants Speech and Language, 7, 333-371 Umeda, N and R Teranishi The parsing program for automatic text -to- speech synthesis ... structure and prosodic phrasing The psycholinguistic and acoustic investigations of Cooper and Paccia-Cooper (1980), Umeda (1982) and Gee and Grosjean ( ) a n d the prosodic theory of Selkirk (1984) are ... the head Adjuncts and modifiers Constituent Length While we may view each boundary as having an intrinsic strength based on constituency and grammatical function, the determination of actual strengths...
- 11
- 287
- 0
báo cáo hóa học:" Evaluation of microfracture of traumatic chondral injuries to the knee in professional football and rugby players" pdf
Ngày tải lên :
20/06/2014, 01:20
... and an additional period of rehabilitation was advised Data and statistical analysis Function and MRI scores were analyzed at months, 12 months and 18 months The healing progress by both modalities ... JW, Hartman W: Quantitative assessment of functional limitation in normal and anterior cruciate Ligament deficient knee Clinical orthopaedic and related research 1990, 255:204-214 Barber-Westin ... had isolated and well defined grade II–III or IV injuries (fig 1) They all had an acute onset of knee pain and effusion as predominant symptoms, and the observed chondral defects were deemed to...
- 8
- 543
- 0
báo cáo hóa học:" Research Article Linking Users’ Subjective QoE Evaluation to Signal Strength in an IEEE 802.11b/g Wireless LAN Environment" doc
Ngày tải lên :
21/06/2014, 18:20
... significance level of 5% A significant difference in Q2, Q4, and Q6 was found between positions and 4, and 4, and and 4, demonstrating that for these questions, the average ratings differ significantly ... software tool in a study in which a panel of test users evaluated a mobile web-browsing application (Wapedia) on a PDA in an indoor IEEE 802.11b/g Wireless LAN environment The aim was to assess and ... the participant than on the available signal strength and, thus, speed Both linear and exponential regression models were applied to the data set In the literature, we found that in case of real-time...
- 12
- 215
- 0
Báo cáo y học: "CD47 associates with alpha 5 integrin and regulates responses of human articular chondrocytes to mechanical stimulation in an in vitro model" pdf
Ngày tải lên :
09/08/2014, 10:22
... articular cartilage (Collins grade 0) obtained from female (age 67 years) and males (median age 71 years, range 53 to 88 years) and osteoarthritic cartilage (Collins grade to 3) obtained from 13 males ... the appropriate antibody and after 20 minutes of mechanical stimulation at 0.33 Hz Bric 126 is a function- blocking anti-CD47/IAP antibody B6H12 is an anti-CD47/IAP antibody that has partial agonist ... transfection studies were undertaken with a human ovarian carcinoma cell line and a mouse lung fibroblast cell line, rather than human chondrocytes, in an attempt to provide additional understanding...
- 11
- 441
- 0
Báo cáo y học: " Substitution of the Rev-response element in an HIV-1-based gene delivery system with that of SIVmac239 allows efficient delivery of Rev M10 into T-lymphocytes" ppsx
Ngày tải lên :
10/08/2014, 05:21
... Erickson J, Pavlakis GN: Analysis of intracellular trafficking and interactions of cytoplasmic HIV1 Rev mutants in living cells Virology 1998, 251:38-48 Stauber R, Gaitanaris GA, Pavlakis GN: Analysis ... employing RNAi approaches Employing distinct RNA transport elements for expression of helper and gene transfer vector RNA can reduce the risk of recombination between the packaging and gene transfer ... Zaboikina T, Schuening F: Cloning and expression of canine O6-methylguanine-DNA methyltransferase in target cells, using gammaretroviral and lentiviral vectors Hum Gene Ther 2004, 15:383-392 Srinivasakumar...
- 13
- 357
- 0
Báo cáo y học: "Induction of HSPA4 and HSPA14 by NBS1 overexpression contributes to NBS1-induced in vitro metastatic and transformation activity" potx
Ngày tải lên :
10/08/2014, 05:21
... overexpression to enhance the in vitro metastatic and transformation activity in contrast to the Snail/MMP2 pathway [17] Materials and methods Cell lines, plasmids, and transfections The non-small cell ... decreased in vitro migration and invasion activity To test the role of HSPA4 and HSPA14 in in vitro migration and invasion activity, siRNA-mediated repression of HSPA4 or HSPA14 was carried out in ... possible heat shock transcription factor which may cause the activation of HSPA4 and HSPA14 These results demonstrate the alternative pathway to induce in vitro metastatic and transformation activity...
- 6
- 405
- 0